Top » Catalog » SNPs » Y11662

$18.00

Y11662
[Y11662]

Y11662
hg38 Position: ChrY:12892325..12892325
Ancestral: G
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below P312 > L238 > Y11661
Forward Primer: Y11662_F ACAAAGCATGACAAGAAGCAAG
Reverse Primer: Y11662_R TCACCCCTTTCCACCCAG
Reviews

Customers who bought this product also purchased
DYS458
DYS458
A6291
A6291
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies