Top » Catalog » SNPs » Z59

$18.00

Z59
[Z59]

Z59
hg38 Position: ChrY:14690480..14690480
Ancestral: G
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2a
Comments: Parallel to L22. downstream Z58. upstream Z60. Z61
Forward Primer: Z59_F AAAATGTTACCACAGCTATGTAGACTATG
Reverse Primer: Z59_R CCTACCCAGTACAAAGAATTTCCTAC
Reviews

Customers who bought this product also purchased
FGC15560
FGC15560
Y11205
Y11205
S10908
S10908
A14157
A14157
S10066
S10066
FGC23806
FGC23806
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies