Top » Catalog » SNPs » Z59

$19.00

Z59
[Z59]

Z59
hg38 Position: ChrY:14690480..14690480
Ancestral: G
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2a
Comments: Parallel to L22. downstream Z58. upstream Z60. Z61
Forward Primer: Z59_F AAAATGTTACCACAGCTATGTAGACTATG
Reverse Primer: Z59_R CCTACCCAGTACAAAGAATTTCCTAC
Reviews

Customers who bought this product also purchased
A1831
A1831
MPB435
MPB435
FGC22161
FGC22161
Prepaid Return Envelope
Prepaid Return Envelope
DNA Sample Kit
DNA Sample Kit
Y68489
Y68489
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies