Top » Catalog » SNPs » Z59

$18.00

Z59
[Z59]

Z59
hg38 Position: ChrY:14690480..14690480
Ancestral: G
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2a
Comments: Parallel to L22. downstream Z58. upstream Z60. Z61
Forward Primer: Z59_F AAAATGTTACCACAGCTATGTAGACTATG
Reverse Primer: Z59_R CCTACCCAGTACAAAGAATTTCCTAC
Reviews

Customers who bought this product also purchased
A11278
A11278
A11282
A11282
Y46501
Y46501
Y18311
Y18311
A11280
A11280
A5644
A5644
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies