Top » Catalog » SNPs » Z6032

$18.00

Z6032
[Z6032]

Z6032
hg38 Position: ChrY:14855721..14855721
Ancestral: T
Derived: G
Reference: Ray Banks (2013)
ISOGG Haplogroup: G2a2b2a1a1c1a2b
Comments: Downstream of L140 > Z1903 > Z3428
Forward Primer: Z6032_F TGTCTCTTGAAAGATAAACCAATGG
Reverse Primer: Z6032_R CCTATTGTGTATACCTCAGGGACC
Reviews

Customers who bought this product also purchased
CTS7045
CTS7045
FGC251
FGC251
Z27232
Z27232
CTS342
CTS342
HU1
HU1
FGC31708
FGC31708
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies