Top » Catalog » SNPs » PF3346

$18.00

PF3346
[PF3346]

PF3346
hg38 Position: ChrY:22351989..22351989
Ancestral: T
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: G2a2b2a1a
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF3346v2_F TGAGGATGGATTCTATTGAAGAGTATG
Reverse Primer: PF3346v2_R GGTACAGAATAGCACATAGAATATACACTG
Reviews

Customers who bought this product also purchased
Z43844
Z43844
FGC37658
FGC37658
FGC37729
FGC37729
FGC37667
FGC37667
FGC12126
FGC12126
FGC37725
FGC37725
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies