Top » Catalog » SNPs » A6308

$18.00

A6308
[A6308]

A6308
hg38 Position: ChrY:16113623..16113623
Ancestral: C
Derived: T
Reference: Peter Desmond Beattie (2015)
ISOGG Haplogroup: R1b
Comments: Below Z255 > A430
Forward Primer: A6308_F GGCTTTGAGTTGGGATGATG
Reverse Primer: A6308_R GCATGCCATTCTACATCCAG
Reviews

Customers who bought this product also purchased
Z16437
Z16437
A476
A476
R1b-Z255 Panel
R1b-Z255 Panel
A430
A430
A1154
A1154
Z16433
Z16433
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies