Top » Catalog » SNPs » A195

$18.00

A195
[A195]

A195
hg38 Position: ChrY:7882703..7882703
Ancestral: T
Derived: C
Reference: Lance Brown (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2
Comments: Parallel to S1121 and upstream of A88. Aka Z16253
Forward Primer: A195_F GGCCCAGGCAGAAAAGTC
Reverse Primer: A195_R GGATATTGGGCTGAGTGTGG
Reviews

Customers who bought this product also purchased
A12588
A12588
A12596
A12596
A11843
A11843
A12594
A12594
R1b-A761 Panel
R1b-A761 Panel
Y878
Y878
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies