Top » Catalog » SNPs » S5488

$18.00

S5488
[S5488]

S5488
hg38 Position: ChrY:16976750..16976750
Ancestral: C
Derived: T
Reference: Jim Wilson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1g3
Comments: Found in a R1b-DF21 person
Forward Primer: S5488_F AATAAGCTGGGCATGGTGAC
Reverse Primer: S5488_R CTTCAGATGTGGGAGCTTGG
Reviews

Customers who bought this product also purchased
U152
U152
FGC14590
FGC14590
Z29644
Z29644
FGC14589
FGC14589
Z245
Z245
M985
M985
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies