Top » Catalog » SNPs » L859

$19.00

L859
[L859]

L859
hg38 Position: ChrY:13908470..13908470
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J1a (not listed)
Comments: Downstream of J-L147.1 > FGC8712
Forward Primer: L859_F ACCCTCAAGATATTCCAGATGTG
Reverse Primer: L859_R TCACATCATGAAGAAAATTCATGAC
Reviews (1)

Customers who bought this product also purchased
ZS4753
ZS4753
DYS388
DYS388
FGC7944
FGC7944
FGC8719
FGC8719
ZS8224
ZS8224
HU257
HU257
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies