Top » Catalog » SNPs » L859

$18.00

L859
[L859]

L859
HG19 Position: ChrY:13908470..13908470
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J1a (not listed)
Comments: Downstream of J-L147.1 > FGC8712
Forward Primer: L859_F ACCCTCAAGATATTCCAGATGTG
Reverse Primer: L859_R TCACATCATGAAGAAAATTCATGAC
Reviews

Customers who bought this product also purchased
FGC1721
FGC1721
YSEQ-Alpha
YSEQ-Alpha
FGC8703
FGC8703
FGC30416
FGC30416
FGC8705
FGC8705
L530
L530
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies