Top » Catalog » SNPs » L859

$18.00

L859
[L859]

L859
hg38 Position: ChrY:13908470..13908470
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J1a (not listed)
Comments: Downstream of J-L147.1 > FGC8712
Forward Primer: L859_F ACCCTCAAGATATTCCAGATGTG
Reverse Primer: L859_R TCACATCATGAAGAAAATTCATGAC
Reviews

Customers who bought this product also purchased
ZS2094
ZS2094
ZS5871
ZS5871
A22247
A22247
FGC9587
FGC9587
ZS4255
ZS4255
CTS8308
CTS8308
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies