Top » Catalog » SNPs » L859

$18.00

L859
[L859]

L859
hg38 Position: ChrY:13908470..13908470
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J1a (not listed)
Comments: Downstream of J-L147.1 > FGC8712
Forward Primer: L859_F ACCCTCAAGATATTCCAGATGTG
Reverse Primer: L859_R TCACATCATGAAGAAAATTCATGAC
Reviews (1)

Customers who bought this product also purchased
FGC7393
FGC7393
CTS11741
CTS11741
FGC4429
FGC4429
ZS3292
ZS3292
FGC1713
FGC1713
ZS3290
ZS3290
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies