Top » Catalog » SNPs » L859

$18.00

L859
[L859]

L859
hg38 Position: ChrY:13908470..13908470
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J1a (not listed)
Comments: Downstream of J-L147.1 > FGC8712
Forward Primer: L859_F ACCCTCAAGATATTCCAGATGTG
Reverse Primer: L859_R TCACATCATGAAGAAAATTCATGAC
Reviews (1)

Customers who bought this product also purchased
WGS400
WGS400
FGC83207
FGC83207
J1-FGC8712 Panel
J1-FGC8712 Panel
ZS3290
ZS3290
Wish a SNP
Wish a SNP
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies