Top » Catalog » SNPs » A178

$18.00

A178
[A178]

A178
hg38 Position: ChrY:13443262..13443262
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A178_F GAAATTTAAGTAGCCCTTCCCG
Reverse Primer: A178_R GCCAACAGCAGGCTCACA
Reviews

Customers who bought this product also purchased
DF21
DF21
Z255
Z255
S1090
S1090
Z39589
Z39589
FGC11134
FGC11134
BY203693
BY203693
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies