Top » Catalog » SNPs » A178

$18.00

A178
[A178]

A178
hg38 Position: ChrY:13443262..13443262
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A178_F GAAATTTAAGTAGCCCTTCCCG
Reverse Primer: A178_R GCCAACAGCAGGCTCACA
Reviews

Customers who bought this product also purchased
FGC11134
FGC11134
BY203693
BY203693
L513
L513
S1105
S1105
MC14
MC14
FGC5496
FGC5496
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies