Top » Catalog » SNPs » Y186743

$18.00

Y186743
[Y186743]

Y186743
hg38 Position: ChrY:12794592..12794592
Ancestral: G
Derived: A
Reference: YFull (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y186743_F AATGGCCATCCTAACGTATGTAAG
Reverse Primer: Y186743_R TCAACAAGGTGCCTAGACCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies