Top » Catalog » SNPs » Y186988

$18.00

Y186988
[Y186988]

Y186988
hg38 Position: ChrY:10044621..10044621
Ancestral: A
Derived: G
Reference: YFull (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y186988_F TTCCAAATTCATATATTAAAACTGTGAAG
Reverse Primer: Y186988_R GCATAATTTATATATGCAAATGTTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies