Top » Catalog » SNPs » FT246074

$18.00

FT246074
[FT246074]

FT246074
hg38 Position: ChrY:13108362..13108362
Ancestral: G
Derived: A
Reference: FTDNA (2020)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT246074_F AAAGCTGTAAAAAGCACTGATGG
Reverse Primer: FT246074_R TTGTATATAGGATGGGTAAAATGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies