Top » Catalog » SNPs » FT247189

$18.00

FT247189
[FT247189]

FT247189
hg38 Position: ChrY:21234739..21234739
Ancestral: T
Derived: C
Reference: FTDNA (2020)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT247189_F GAGCCTTTGATTCTGCCATC
Reverse Primer: FT247189_R CATTACAAAGATCATTCATCATGATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies