Top » Catalog » SNPs » Y194954

$18.00

Y194954
[Y194954]

Y194954
hg38 Position: ChrY:13781632..13781632
Ancestral: T
Derived: C
Reference: YFull (2020)
ISOGG Haplogroup: R1b
Comments: Below P312 > Y22430
Forward Primer: Y194954_F ATTCTTTTTTCTCTAAAATTCTCTTCTCC
Reverse Primer: Y194954_R TACAACAGACCTGCAGCTGC
Reviews

Customers who bought this product also purchased
Y195334
Y195334
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies