Top » Catalog » SNPs » FT258017

$18.00

FT258017
[FT258017]

FT258017
hg38 Position: ChrY:26426308..26426308
Ancestral: C
Derived: T
Reference: FTDNA (2020)
ISOGG Haplogroup: R1b
Comments: Below P312 > Y22430
Forward Primer: FT258017_F TATATATATATATATTTTTGAGACTGAGTCTCATG
Reverse Primer: FT258017_R ATTAGGCCAGGTGCAATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies