Top » Catalog » SNPs » A26725

$18.00

A26725
[A26725]

A26725
hg38 Position: ChrY:2995190..2995190
Ancestral: A
Derived: G
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: Below Z643 > Y126240
Forward Primer: A26725_F TGAGACTTTTGGGAAGAACTGAG
Reverse Primer: A26725_R TTCCCCAAAGATCAGGAATG
Reviews

Customers who bought this product also purchased
A26727
A26727
A26730
A26730
A26728
A26728
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies