Top » Catalog » SNPs » Y177575

$18.00

Y177575
[Y177575]

Y177575
hg38 Position: ChrY:15571797..15571797
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: Below L38 > PH1237 > Y125026
Forward Primer: Y177575_F GGTGTATGAGAATGCTTGTGATTG
Reverse Primer: Y177575_R GCGTCTGTTCATATCCTTCGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies