Top » Catalog » SNPs » Y177575

$18.00

Y177575
[Y177575]

Y177575
hg38 Position: ChrY:15571797..15571797
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: Below L38 > PH1237 > Y125026
Forward Primer: Y177575_F GGTGTATGAGAATGCTTGTGATTG
Reverse Primer: Y177575_R GCGTCTGTTCATATCCTTCGG
Reviews

Customers who bought this product also purchased
Z59
Z59
Y31038
Y31038
Z2336
Z2336
S2606
S2606
BY184790
BY184790
I1 Superclade Panel
I1 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies