Top » Catalog » SNPs » Y177577

$18.00

Y177577
[Y177577]

Y177577
hg38 Position: ChrY:20854922..20854922
Ancestral: G
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: Below L38 > PH1237 > Y125026
Forward Primer: Y177577_F GAGTGCATGTGTCGAGGAAC
Reverse Primer: Y177577_R AGCAGACCTAATAGACATCTACAGAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies