Top » Catalog » SNPs » MF15118

$18.00

MF15118
[MF15118]

MF15118
hg38 Position: ChrY:12635641..12635641
Ancestral: T
Derived: A
Reference: 23mofang (2018)
ISOGG Haplogroup: O
Comments: Below P201 > A9459 > Y8387
Forward Primer: MF15118_F CCTGTAGTCCCAGCTACTCAGC
Reverse Primer: MF15118_R CACAATGTGACCTCACTTGTATGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies