Top » Catalog » SNPs » A189

$18.00

A189
[A189]

A189
hg38 Position: ChrY:19537540..19537540
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A189_F TCACCATGTTGGCTATGAGG
Reverse Primer: A189_R TTTTGGTGAGGTGTCTCTTCAG
Reviews

Customers who bought this product also purchased
A175
A175
A193
A193
A163
A163
A180
A180
A169
A169
A186
A186
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies