Top » Catalog » SNPs » A194

$18.00

A194
[A194]

A194
hg38 Position: ChrY:9299121..9299121
Ancestral: G
Derived: A
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l2~
Comments: Found in a R1b-FGC5496/S1088 person.
Forward Primer: A194_F TATATATATATATGCTAAAGCTTCATCCTTGT
Reverse Primer: A194_R GGACTCTGACTATGAAATCCTCAGA
Reviews

Customers who bought this product also purchased
A2121
A2121
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Z253
Z253
S1088
S1088
L21
L21
Z251
Z251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies