Top » Catalog » SNPs » S756

$18.00

S756
[S756]

S756
hg38 Position: ChrY:15029786..15029786
Ancestral: A
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k1a1c
Comments: Downstream of L1065 S764
Forward Primer: S756_F TGAGACATTAACACAAATCCAGAAG
Reverse Primer: S756_R TTGAGACAGAGTCTCTCTGTGTCAC
Reviews

Customers who bought this product also purchased
S9767
S9767
FGC32994
FGC32994
FGC19785
FGC19785
FGC45280
FGC45280
FGC18451
FGC18451
A1321
A1321
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies