Top » Catalog » SNPs » S24902

$19.00

S24902
[S24902]

S24902
hg38 Position: ChrY:20774854..20774854
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1a1a1b1a2c
Comments: Downstream R1a-Z280 and parallel to CTS1211 and Z92
Forward Primer: S24902_F CAATCTCCTGACCTCGTAATCC
Reverse Primer: S24902_R TCAAACTGGAGCCGAATACC
Reviews

Customers who bought this product also purchased
Y35868
Y35868
Y35862
Y35862
YP6218
YP6218
YP5000
YP5000
Y2395
Y2395
Prepaid Return Envelope
Prepaid Return Envelope
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies