Top » Catalog » SNPs » Y2395

$18.00

Y2395
[Y2395]

Y2395
hg38 Position: ChrY:19032335..19032335
Ancestral: T
Derived: G
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b1a3 (not listed)
Comments: Downstream R1a-Z282
Forward Primer: Y2395_F TTCCAATCCAAATAGACAGTGG
Reverse Primer: Y2395_R TTTCAGTGAGCCAAGACTGC
Reviews

Customers who bought this product also purchased
Y23849
Y23849
YP4659
YP4659
YP979
YP979
FGC39341
FGC39341
Y17619
Y17619
YP1412
YP1412
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies