Top » Catalog » SNPs » Y2395

$18.00

Y2395
[Y2395]

Y2395
hg38 Position: ChrY:19032335..19032335
Ancestral: T
Derived: G
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b1a3 (not listed)
Comments: Downstream R1a-Z282
Forward Primer: Y2395_F TTCCAATCCAAATAGACAGTGG
Reverse Primer: Y2395_R TTTCAGTGAGCCAAGACTGC
Reviews

Customers who bought this product also purchased
Z2902
Z2902
CTS8816
CTS8816
Y3222
Y3222
YP4968
YP4968
Y184194
Y184194
Y72918
Y72918
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies