Top » Catalog » SNPs » Y2395

$18.00

Y2395
[Y2395]

Y2395
hg38 Position: ChrY:19032335..19032335
Ancestral: T
Derived: G
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b1a3 (not listed)
Comments: Downstream R1a-Z282
Forward Primer: Y2395_F TTCCAATCCAAATAGACAGTGG
Reverse Primer: Y2395_R TTTCAGTGAGCCAAGACTGC
Reviews

Customers who bought this product also purchased
YP258
YP258
L62
L62
Y184194
Y184194
Z4624
Z4624
Y72918
Y72918
M343
M343
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies