Top » Catalog » SNPs » Y2395

$18.00

Y2395
[Y2395]

Y2395
hg38 Position: ChrY:19032335..19032335
Ancestral: T
Derived: G
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b1a3 (not listed)
Comments: Downstream R1a-Z282
Forward Primer: Y2395_F TTCCAATCCAAATAGACAGTGG
Reverse Primer: Y2395_R TTTCAGTGAGCCAAGACTGC
Reviews

Customers who bought this product also purchased
Y40
Y40
Y34286
Y34286
YP1506
YP1506
KMS133
KMS133
BY9
BY9
Y20787
Y20787
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies