Top » Catalog » SNPs » YP235

$18.00

YP235
[YP235]

YP235
hg38 Position: ChrY:14159548..14159548
Ancestral: A
Derived: G
Reference: Vladimir Tagankin (2014)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Downstream R1a-CTS3402
Forward Primer: YP235_F GCCGAAATCCCTGTTGTATG
Reverse Primer: YP235_R TAAGTGTTTTCTCTAGTTGGTATTGGC
Reviews

Customers who bought this product also purchased
A25193
A25193
YP1018
YP1018
YP234
YP234
L145
L145
M168
M168
Y42985
Y42985
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies