Top » Catalog » SNPs » YP237

$18.00

YP237
[YP237]

YP237
hg38 Position: ChrY:21232793..21232793
Ancestral: A
Derived: G
Reference: Vladimir Tagankin (2014)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Downstream R1a-CTS3402
Forward Primer: YP237v2_F CAAACACAGGTGTGCATATGTC
Reverse Primer: YP237v2_R GGATAACCCATGAAACCTGAAAG
Reviews

Customers who bought this product also purchased
Y80733
Y80733
Y201632
Y201632
Y16755
Y16755
YP350
YP350
YP4465
YP4465
YP1080
YP1080
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies