Top » Catalog » SNPs » YP237

$18.00

YP237
[YP237]

YP237
hg38 Position: ChrY:21232793..21232793
Ancestral: A
Derived: G
Reference: Vladimir Tagankin (2014)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Downstream R1a-CTS3402
Forward Primer: YP237v2_F CAAACACAGGTGTGCATATGTC
Reverse Primer: YP237v2_R GGATAACCCATGAAACCTGAAAG
Reviews

Customers who bought this product also purchased
YP4441
YP4441
BY3502
BY3502
YP4707
YP4707
S24902
S24902
YP581
YP581
YP6026
YP6026
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies