Top » Catalog » SNPs » YP237

$18.00

YP237
[YP237]

YP237
hg38 Position: ChrY:21232793..21232793
Ancestral: A
Derived: G
Reference: Vladimir Tagankin (2014)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Downstream R1a-CTS3402
Forward Primer: YP237v2_F CAAACACAGGTGTGCATATGTC
Reverse Primer: YP237v2_R GGATAACCCATGAAACCTGAAAG
Reviews

Customers who bought this product also purchased
A25193
A25193
BY27373
BY27373
Y2194
Y2194
YP5225
YP5225
YP6214
YP6214
YP5000
YP5000
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies