Top » Catalog » SNPs » YP310

$18.00

YP310
[YP310]

YP310
hg38 Position: ChrY:17166540..17166540
Ancestral: A
Derived: C
Reference: Vladimir Tagankin (2014)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Downstream R1a-CTS3402
Forward Primer: YP310_F TGTAATATCCTCACCTGATCTATTACATC
Reverse Primer: YP310_R TTTGGTGTACTTCTCTTGTTCCAG
Reviews

Customers who bought this product also purchased
Z92
Z92
Y2902
Y2902
YP5995
YP5995
Z91
Z91
CTS8816
CTS8816
Y29593
Y29593
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies