Top » Catalog » SNPs » YP310

$18.00

YP310
[YP310]

YP310
HG19 Position: ChrY:19278420..19278420
Ancestral: A
Derived: C
Reference: Vladimir Tagankin (2014)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Downstream R1a-CTS3402
Forward Primer: YP310_F TGTAATATCCTCACCTGATCTATTACATC
Reverse Primer: YP310_R TTTGGTGTACTTCTCTTGTTCCAG
Reviews

Customers who bought this product also purchased
CDY
CDY
DYS390
DYS390
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
DYS607
DYS607
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14637
1 x HVR2
1 x mtComplete
1 x HVR1
$247.00
Haplogroup Info
Other products
Currencies