Top » Catalog » SNPs » YP310

$18.00

YP310
[YP310]

YP310
hg38 Position: ChrY:17166540..17166540
Ancestral: A
Derived: C
Reference: Vladimir Tagankin (2014)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Downstream R1a-CTS3402
Forward Primer: YP310_F TGTAATATCCTCACCTGATCTATTACATC
Reverse Primer: YP310_R TTTGGTGTACTTCTCTTGTTCCAG
Reviews

Customers who bought this product also purchased
CTS8816
CTS8816
Y29593
Y29593
R1a-Z280 Panel
R1a-Z280 Panel
YP237
YP237
FGC10360
FGC10360
BY3303
BY3303
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies