Top » Catalog » SNPs » FT207288

$18.00

FT207288
[FT207288]

FT207288
hg38 Position: ChrY:13606558..13606558
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FT207288_F AGAGGAATGCACAAAACATAAAGG
Reverse Primer: FT207288_R ACTGGGCACAGCATCTCTG
Reviews

Customers who bought this product also purchased
FT207644
FT207644
FT69043
FT69043
FT68015
FT68015
DYS715
DYS715
DYS712
DYS712
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies