Top » Catalog » SNPs » FGC7937

$18.00

FGC7937
[FGC7937]

FGC7937
hg38 Position: ChrY:16759146..16759146
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC7937_F CTGAGAACTTCGAATATATTTATTCATTG
Reverse Primer: FGC7937_R ATTATAGTGATGGTTAAATGGAAAGCC
Reviews

Customers who bought this product also purchased
FGC1707
FGC1707
FGC1715
FGC1715
FGC4262
FGC4262
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC7
FGC7
ZS1862
ZS1862
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies