Top » Catalog » SNPs » Z5018

$18.00

Z5018
[Z5018]

Z5018
hg38 Position: ChrY:26567613..26567613
Ancestral: G
Derived: T
Reference: G. Magoon et al. (2013)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: downstream from V13 & upstream from L17 parallel to Z5016/Z5017
Forward Primer: Z5018_F ACTTTGGTGAACTATCCTAAGGGTC
Reverse Primer: Z5018_R AGTGTTCTTCTACTCAGCTCCCAT
Reviews

Customers who bought this product also purchased
BY4317
BY4317
YP223
YP223
BY4281
BY4281
BY4363
BY4363
FGC33625
FGC33625
A10158
A10158
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies