Top » Catalog » SNPs » Z5018

$18.00

Z5018
[Z5018]

Z5018
hg38 Position: ChrY:26567613..26567613
Ancestral: G
Derived: T
Reference: G. Magoon et al. (2013)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: downstream from V13 & upstream from L17 parallel to Z5016/Z5017
Forward Primer: Z5018_F ACTTTGGTGAACTATCCTAAGGGTC
Reverse Primer: Z5018_R AGTGTTCTTCTACTCAGCTCCCAT
Reviews

Customers who bought this product also purchased
BY159269
BY159269
BY189808
BY189808
Y129143
Y129143
Y128213
Y128213
Y128502
Y128502
BY157133
BY157133
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies