Top » Catalog » SNPs » Z5018

$18.00

Z5018
[Z5018]

Z5018
hg38 Position: ChrY:26567613..26567613
Ancestral: G
Derived: T
Reference: G. Magoon et al. (2013)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: downstream from V13 & upstream from L17 parallel to Z5016/Z5017
Forward Primer: Z5018_F ACTTTGGTGAACTATCCTAAGGGTC
Reverse Primer: Z5018_R AGTGTTCTTCTACTCAGCTCCCAT
Reviews

Customers who bought this product also purchased
FT91330
FT91330
S25577
S25577
Y30991
Y30991
Y81971
Y81971
BY4526
BY4526
Y6227
Y6227
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies