Top » Catalog » SNPs » Y48979

$18.00

Y48979
[Y48979]

Y48979
hg38 Position: ChrY:11971304..11971304
Ancestral: T
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: Y48979_F CAATGGGAGAAAATTACACCCTC
Reverse Primer: Y48979_R CCACATCCTCAAGCTCGTTAAC
Reviews

Customers who bought this product also purchased
YP4090
YP4090
R1a-Z93 Panel
R1a-Z93 Panel
YP4094
YP4094
YP565
YP565
Y33
Y33
S24902
S24902
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies