Top » Catalog » SNPs » BY183277

$18.00

BY183277
[BY183277]

BY183277
hg38 Position: ChrY:15252091..15252091
Ancestral: T
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY183277_F CACTTCAGCCTTTATGACATGTG
Reverse Primer: BY183277_R ATGAGGATTTTCCATTGCAGAG
Reviews

Customers who bought this product also purchased
FT294363
FT294363
ZS7428
ZS7428
J1-L860 Panel
J1-L860 Panel
Wish a SNP
Wish a SNP
FT344373
FT344373
Y198676
Y198676
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies