Top » Catalog » SNPs » BY183277

$18.00

BY183277
[BY183277]

BY183277
hg38 Position: ChrY:15252091..15252091
Ancestral: T
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY183277_F CACTTCAGCCTTTATGACATGTG
Reverse Primer: BY183277_R ATGAGGATTTTCCATTGCAGAG
Reviews

Customers who bought this product also purchased
ZS11325
ZS11325
ZS7438
ZS7438
ZS7484
ZS7484
L860
L860
FT294363
FT294363
Y198676
Y198676
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies