Top » Catalog » SNPs » Y91969

$18.00

Y91969
[Y91969]

Y91969
hg38 Position: ChrY:12582140..12582140
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y91969_F TGAGATAGAGTCTCACTTTGTTGCC
Reverse Primer: Y91969_R TTTTGTAGTAGTCTAATGATTTGAGACCTTAG
Reviews

Customers who bought this product also purchased
BY74
BY74
HU263
HU263
FGC5230
FGC5230
BY162752
BY162752
Z2293
Z2293
ZS1431
ZS1431
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies